79
79
Jan 24, 2013
01/13
by
CURRENT
tv
eye 79
favorite 0
quote 0
mark my words, they will shut the government down. they will do whatever they need to do. they will be as obstinate as humanly possible. they will sacrifice everything, the republicans will. the only thing they will not sacrifice are the bondholders who are their bosses. all right when we come back, a gun buy back in los angeles actually brought in rpgs rocket propelled grenades. is it a smart idea to do that or not? we'll talk to the guy running the program when we return. >> shotguns, pistols and even assault rifles, some rusted, some brand new. la county sheriff deputy stacked them. the weapons will be catatatatatatatatatatatatatatatatatatatatatatatatatatatatatat and good luck. ♪ uh, i'm in a timeout because apparently riding the dog like it's a small horse is frowned upon in this establishment! luckily though, ya know, i conceal this bad boy underneath my blanket just so i can get on e-trade. check my investment portfolio, research stocks... wait, why are you taking... oh, i see...solitary. just a man and his thoughts. and a smartphone... with an e-trade app. ♪ nob
mark my words, they will shut the government down. they will do whatever they need to do. they will be as obstinate as humanly possible. they will sacrifice everything, the republicans will. the only thing they will not sacrifice are the bondholders who are their bosses. all right when we come back, a gun buy back in los angeles actually brought in rpgs rocket propelled grenades. is it a smart idea to do that or not? we'll talk to the guy running the program when we return. >> shotguns,...
139
139
Jan 29, 2013
01/13
by
COM
tv
eye 139
favorite 0
quote 0
maybe you put a lid on this sexual misbehavior by again have some sort of standard or code that governs how the military conducts itself. some kind of a military code of conduct, if you will. but even that won't address the biggest hazard ladies present our fighting men. >> if you had to go to a rest room, pee in a bottle inches from the comrade next to you. if you develop dysentery you had to pooh in a bag inches from your comrade's face. introducing women into that environment can be really traumatic and humiliating. >> jon: i'm going to jump in here. first of all, i know a lot of german businessmen who would pay good money for that. secondly, you're in a war zone. you're in a war zone and your big worry is dying of embarrassment? and by the way, i think i figured something out here. if men are going to be poohing inches from their female comrade's face, i believe that solves your eros problem. eros is irrational but it's not [bleep] crazy. all right. our own samantha bee explores this more in depth with this report >> reporter: last week defense secretary leon panetta made military h
maybe you put a lid on this sexual misbehavior by again have some sort of standard or code that governs how the military conducts itself. some kind of a military code of conduct, if you will. but even that won't address the biggest hazard ladies present our fighting men. >> if you had to go to a rest room, pee in a bottle inches from the comrade next to you. if you develop dysentery you had to pooh in a bag inches from your comrade's face. introducing women into that environment can be...
101
101
Jan 24, 2013
01/13
by
CURRENT
tv
eye 101
favorite 0
quote 0
mark my words, they will shut the government down. they will do whatever they need to do. they will be as obstinate as humanly possible. they will sacrifice everything, the republicans will. the only thing they will not sacrifice are the bondholders who are their bosses. all right when we come back, a gun buy back in los angeles actually brought in rpgs rocket propelled grenades. is it a smart idea to do that or not? we'll talk to the guy running the program when we return. >> shotguns, pistols and even assault rifles, some rusted, some brand new. la county sheriff deputy stacked them. the weapons will be cataloged and then destroyed. here a cheap, there a cheap, everywhere a cheap... you get it. so, what if instead of just a cheap choice you could make a smart choice? like, esurance for example. they were born online and built to save people money from the beginning. it's what they've always done. not just something they cheap about. that's insurance for the modern world. esurance. now backed by allstate. click or call. >> cenk: you know, we try to bring attention to peop
mark my words, they will shut the government down. they will do whatever they need to do. they will be as obstinate as humanly possible. they will sacrifice everything, the republicans will. the only thing they will not sacrifice are the bondholders who are their bosses. all right when we come back, a gun buy back in los angeles actually brought in rpgs rocket propelled grenades. is it a smart idea to do that or not? we'll talk to the guy running the program when we return. >> shotguns,...
184
184
Jan 24, 2013
01/13
by
CNNW
tv
eye 184
favorite 0
quote 0
didn't say much other than we're working with the tunisian government. one suspect was released. >> they say he's under observation. >> they weren't ready to bring charges yet. you know, anderson, here's the problem. the bad guys understand this. they are watching. there hasn't been anybody brought to justice. they understand very well the environment they are operating in. security services have melted away after the arab spring. borders are easy to cross. weapons are easily assessable. the bad guys have an advantage. the longer it takes to bring an investigation to a conclusion and hold people accountable suggests to the bad guys that they have a free operating environment and americans are at risk throughout that region. >> interesting. fran, appreciate it. >>> diane o'meara learned from a reporter she was the face of manti te'o's fake girlfriend. her stolen image is at the center of an entire hoax that changed the way some people see the star linebacker. she joins me live ahead. >>> a controversial new book explores the church's interest in hollywood
didn't say much other than we're working with the tunisian government. one suspect was released. >> they say he's under observation. >> they weren't ready to bring charges yet. you know, anderson, here's the problem. the bad guys understand this. they are watching. there hasn't been anybody brought to justice. they understand very well the environment they are operating in. security services have melted away after the arab spring. borders are easy to cross. weapons are easily...
153
153
Jan 27, 2013
01/13
by
CNNW
tv
eye 153
favorite 0
quote 0
government by targeting this website. it contained a long warning threatening to release sensitive information about the department of justice in what it calls war heads, these are named after supreme court justices. you may never have browsed ussc.gov, but they said that there's a reason that they select method website, to target -- selected this website. earlier today, the fbi said they were aware of the cyber attack as soon as it happened and they are handling it as a criminal investigation. don? >> emily, thank you very much. anonymous, a hacker group has inserted itself into several news stories. they took a stand in a rape case that hit a small down in ohio, posting a video of one of the suspects and encouraging large scale protests. president obama will make a appearance with 60 minutes on the exit of hillary clinton. >> why did you want to do this together? a joint interview? >> the main thing is i wanted to have a chance to publically say thank you. because i think hillary will go down as one of the finest secret
government by targeting this website. it contained a long warning threatening to release sensitive information about the department of justice in what it calls war heads, these are named after supreme court justices. you may never have browsed ussc.gov, but they said that there's a reason that they select method website, to target -- selected this website. earlier today, the fbi said they were aware of the cyber attack as soon as it happened and they are handling it as a criminal investigation....
147
147
Jan 25, 2013
01/13
by
CNNW
tv
eye 147
favorite 0
quote 0
we know little more about him today than when he took over the government for his father king jong-il. what what we do know, he's in his late 20s, spent some time in a swiss boarding school and he married the woman to his left on your screen. we have not seen her since these pictures came out. no idea if they're still married, if she's still on the scene. now uppermost in a lot of minds of the people, is this man calling the shots? is the military calling the shots? who exactly is in control and what does control mean in that country? this week kim's government unlived some very firy rhetoric, threats against the united nations and united states. and key ally south korea. the warning, more rocket tests and the latest one coming today, a warning to the south of, quote, strong physical counter measures, end quote, if the south helps to enforce new u.n. sanctions against the north, sanctions imposed after north korea's rocket launch last month. washington believes they're trying to develop missiles that could hit the united states, missiles that could one day possibly be armed with nucle
we know little more about him today than when he took over the government for his father king jong-il. what what we do know, he's in his late 20s, spent some time in a swiss boarding school and he married the woman to his left on your screen. we have not seen her since these pictures came out. no idea if they're still married, if she's still on the scene. now uppermost in a lot of minds of the people, is this man calling the shots? is the military calling the shots? who exactly is in control...
149
149
Jan 23, 2013
01/13
by
CNNW
tv
eye 149
favorite 0
quote 0
it's one of the worst state governments in the country. so if those tax dollars were buying a great efficient terrific public sector, that would be one thing. but instead, it's paying for mediocrity yet they keep asking for more and more. >> that brings me to a point. when phil mickelson was asked would you leave california or the united states because of taxes, he said i'm not sure. but you know what, when taxes get to a certain point, people start to make those decisions and it's easy to point and say you're not patriotic. maybe part of the problem is with the taxes. >> first of all, he's the gerard depardieux because he decided to leave france and go to russia. i was going to talk about notorious b.i.g. song, "mo money, mo problems." look, this is california. governor ann richards when she was governor and i was covering politics there, she would go to california to recruit companies to move to texas because of what, taxes. you have governor rick perry who sent a tweet to phil mickelson saying come on to texas. a lot of people live in t
it's one of the worst state governments in the country. so if those tax dollars were buying a great efficient terrific public sector, that would be one thing. but instead, it's paying for mediocrity yet they keep asking for more and more. >> that brings me to a point. when phil mickelson was asked would you leave california or the united states because of taxes, he said i'm not sure. but you know what, when taxes get to a certain point, people start to make those decisions and it's easy...
150
150
Jan 25, 2013
01/13
by
CNNW
tv
eye 150
favorite 0
quote 0
defense secretary leon panetta said the government is concerned by north korea's continuing provocative behavior and that the united states is ready to deal with it. >> the usa department issued a warning advising people not to travel to benghazi, libya. they said there's a significant potential for violence and kidnapping. >> and apple stock plunged more than 12% today. apple shares have been on the decline for months. investors are concerned about the company's prospects for growth. >> and anderson, it is cold all over. take a look at these chimps at a sanctuary in wales. they're wrapping themselves up in blankets and drinking hot tea to keep warm. don't you think of "e.t." when you see that? >> it reminds me of me on the night of the inauguration when we were cold and wrapped in the blankets. >> i think the chimps are way cuter. >> words hurt, isha. words hurt. >> not that you're not cute. >> lawsuits over an inch of a sandwich. the ridiculist is next. ♪ [ male announcer ] robitussin® liquid formula soothes your throat on contact and the active ingredient relieves your cough. robi
defense secretary leon panetta said the government is concerned by north korea's continuing provocative behavior and that the united states is ready to deal with it. >> the usa department issued a warning advising people not to travel to benghazi, libya. they said there's a significant potential for violence and kidnapping. >> and apple stock plunged more than 12% today. apple shares have been on the decline for months. investors are concerned about the company's prospects for...
622
622
Jan 24, 2013
01/13
by
CURRENT
tv
eye 622
favorite 0
quote 0
i got to work with great staff, and it gave me a taste for what good government really can do and really whetted my appetite for it. >> jennifer: so are you going to run? >> i haven't decided yet. i'm very very serious about this. i spent time thinking about it my family and many colleagues and state holders, i am going to continue to listen for a while and then make up my mind. it's a great time for states now. we all know the problems in washington, and states can take the lead. i think massachusetts is a terrific place to show everybody what can be done by working together. >> jennifer: you are totally right that the actions can be now in the states especially with gridlock in congress. the states can be the laboratories of democracy that they should be and help to show solutions that can be spread across the country. as part of your listening tour if you will have you spoken with senator warren? >> yes, i have. she has just been wonderful. i have enjoyed watching her campaign, and now her new services as senator she has been extremely helpful to me. and i'm very grateful for it. >> j
i got to work with great staff, and it gave me a taste for what good government really can do and really whetted my appetite for it. >> jennifer: so are you going to run? >> i haven't decided yet. i'm very very serious about this. i spent time thinking about it my family and many colleagues and state holders, i am going to continue to listen for a while and then make up my mind. it's a great time for states now. we all know the problems in washington, and states can take the lead. i...
170
170
Jan 24, 2013
01/13
by
CNNW
tv
eye 170
favorite 0
quote 0
if you're a republican president or democratic president, you don't want divided government. you want a house and a senate that's in your hands. karl rove, he talked about a permanent republican majority. he was trying to set up a system where the country at least 50% would vote for a republican president, republican house, republican senate. didn't last long. so that's what you try to do. republicans love talking about ronald reagan. why? the reagan revolution. to this day they talk about him. why? from 1980 all of the way through 2000 it's been all about reagan. this is what you do. i don't understand, speaker boehner. >> what about -- so issues like gay rights which he mentioned there. what about practicality? what does this do to a lot of democrats that live in red states where people don't agree with that. they're running for re-election in 2014. >> do you vote based upon one issue or do you look at a variety of issues? same thing about the issue of choice. there are some people out there who say i am only going to vote based upon whether or not you are pro-choice or pro
if you're a republican president or democratic president, you don't want divided government. you want a house and a senate that's in your hands. karl rove, he talked about a permanent republican majority. he was trying to set up a system where the country at least 50% would vote for a republican president, republican house, republican senate. didn't last long. so that's what you try to do. republicans love talking about ronald reagan. why? the reagan revolution. to this day they talk about him....
157
157
Jan 28, 2013
01/13
by
CNNW
tv
eye 157
favorite 0
quote 0
the riots erupted after the government announced death sentences for people involved in last year's violent soccer stadium riots. mohammed morsi declayed a state of emergency and set a 30-day curfew in several cities. >>> actors got to honor each other at tonight's screen actors guild awards. 22-year-old jennifer lawrence won an award for her work in "silver linings playbook." we'll have more winners from tonight's sag awards in just a few minutes. >>> president barack obama is weighing in on the controversy over the links between football and the potential for brain damage. mr. obama tells the new republic he would have to think long and hard before i'd let him play football. he's especially concerned about college football players who aren't getting paid for the risks they take. >>> scientists don't really know how we get the flu, but something called the flu machine could help us figure it out. we'll show it to you. d toss! see that's much better! that was good. you had your shoulder pointed, you kept your eyes on your target. let's do it again -- watch me. just like that one... [ male a
the riots erupted after the government announced death sentences for people involved in last year's violent soccer stadium riots. mohammed morsi declayed a state of emergency and set a 30-day curfew in several cities. >>> actors got to honor each other at tonight's screen actors guild awards. 22-year-old jennifer lawrence won an award for her work in "silver linings playbook." we'll have more winners from tonight's sag awards in just a few minutes. >>> president...
222
222
Jan 27, 2013
01/13
by
KGO
tv
eye 222
favorite 0
quote 0
investigation and that crosses a line that hasn't been crossed really since the '40s when you talk about government investigating movies. >> what is this movie? what were you trying to do? it is in so many ways the first draft of history. >> for me it was an opportunity to shine a light on the last ten years and portray the human beings at the center of the hunt for the world's most dangerous man. >> mark? >> you know, to the extent that it helps that story enter the popular imagination and the culture and our history, it's done, you know, a wonderful service. >> thank you both very much for joining us this morning, and speaking of service and sacrifice, we now pause to honor our fellow americans who do just that. ♪ this week the pentagon released the name of one soldier killed in afghanistan. >>> and now we turn to a special voice this morning, someone i recognized this week from long ago, a soldier president obama turned to at the commander of chief's inaugural ball via satellite from afghanistan. >> mr. president, we're honored to be able to join you tonight. >> i last sat down with major gene
investigation and that crosses a line that hasn't been crossed really since the '40s when you talk about government investigating movies. >> what is this movie? what were you trying to do? it is in so many ways the first draft of history. >> for me it was an opportunity to shine a light on the last ten years and portray the human beings at the center of the hunt for the world's most dangerous man. >> mark? >> you know, to the extent that it helps that story enter the...
106
106
Jan 24, 2013
01/13
by
CNNW
tv
eye 106
favorite 0
quote 0
government robert ford answered no he is not. i think he is a refugee. >> when the president's own mother leaves the country that signifies things are not good for him. >> the uae seems happy to welcome the family of bashar al assad as they flee. definitely an interesting development in terms of assad's own family and his mother who has been rumored over the last several months since the civil war began to be the one encouraging him to crack down more forcefully. she is the widow of bashar al assad's father. >>> the announcement that women will have the right to fight. we will take a look at one unit in georgia that is ready to go. u the mvp of savings. look at that price. wow! walmart lowers thousands of prices every week. if you find a lower advertised price, they'll match it at the register. no way! yeah! touchdown! ready? get out! that's the walmart low price guarantee! see for yourself! bring in your last receipt, see how much you can save. see for yourself! get great prices on everything you need for your game time party. l
government robert ford answered no he is not. i think he is a refugee. >> when the president's own mother leaves the country that signifies things are not good for him. >> the uae seems happy to welcome the family of bashar al assad as they flee. definitely an interesting development in terms of assad's own family and his mother who has been rumored over the last several months since the civil war began to be the one encouraging him to crack down more forcefully. she is the widow of...
106
106
Jan 24, 2013
01/13
by
CNNW
tv
eye 106
favorite 0
quote 0
they have seen two devices being tested, but you talk to all the experts inside and outside government. north korea doesn't have the long range missile capability to reach the united states and it does not have the ability to put a nuclear warhead on to a missile. right now it doesn't have it. it's much more of an ongoing threat and somebody that has to be dealt with and definitely a rhetorical threat. >> that are out of the way, north korea feels betrayed by china. it sided with the u.s.-led sanctions. how does our rep with china play into all of this? china is the only major diplomatic ally in the region. >> it's incredibly important because the united states said it needs to be in the negotiations and not bilaterally, but with china and japan and the other countries which are evolved. china is the that is considered to have the most leverage with north corae because it shares a border and gives a lot of aid and a lot of engage ams and leadership of both countries meeting on a fairly regular basis. china doesn't want to see the tests by north korea. china getz angry when there the nu
they have seen two devices being tested, but you talk to all the experts inside and outside government. north korea doesn't have the long range missile capability to reach the united states and it does not have the ability to put a nuclear warhead on to a missile. right now it doesn't have it. it's much more of an ongoing threat and somebody that has to be dealt with and definitely a rhetorical threat. >> that are out of the way, north korea feels betrayed by china. it sided with the...
132
132
Jan 24, 2013
01/13
by
CNNW
tv
eye 132
favorite 0
quote 0
i don't know that i want the government -- i don't trust the government. i'm a kid of the '60s. >> i tried to immerse myself into all of the arguments without taking a sort of lofty, patronizing view of it. many americans share that view. i don't understand why there's a fear of tyranny given no overseas tyranny could compete with the american military. you are left with domestic tyranny. if your own government becomes radical, they have 5,000 nuclear warheads. how do you possibly defend yourselves? >> yes. >> as many u.s. marines have tweeted me, nor can i see a situation where the american armed forces would go against their own people. >> that's egypt when you watched the egyptian military turn that revolution by saying we won't gun down egyptians in the street. you hope that's the case. i'm saying that it's a different interpretation of second amendment. >> how much do you think lyrics perhaps in music that allude to guns, you have written a song that includes a line of placing a gun to her head and now she's dead. >> not because of the dress. he had g
i don't know that i want the government -- i don't trust the government. i'm a kid of the '60s. >> i tried to immerse myself into all of the arguments without taking a sort of lofty, patronizing view of it. many americans share that view. i don't understand why there's a fear of tyranny given no overseas tyranny could compete with the american military. you are left with domestic tyranny. if your own government becomes radical, they have 5,000 nuclear warheads. how do you possibly defend...
171
171
Jan 24, 2013
01/13
by
MSNBCW
tv
eye 171
favorite 0
quote 0
congress is in an independent branch of government. and i disagreed with some of the comments made, but i had no problem with them being made. they diminished some of the people who made them, but that was the choice of those people. >> yeah. she was just fine. i just -- i'm not sure we even -- let me just get peter alexander who's standing out in the freezing cold outside the white house. and what are you hearing from inside the white house about how hillary clinton did yesterday? >> reporter: well, i think they thought she was perfect. they thought she was excellent. jay carney, press secretary, was asked about that and said she has been one of this country's greatest secretaries of state. we should note to the people in the d.c. area that snowplows are out behind us for the first time this winter, so drive safely as they head out the door this morning. but what was striking to me, mika, as i watched this conversation, these questions being peppered at the secretary of state yesterday is what the last two months of the republican cam
congress is in an independent branch of government. and i disagreed with some of the comments made, but i had no problem with them being made. they diminished some of the people who made them, but that was the choice of those people. >> yeah. she was just fine. i just -- i'm not sure we even -- let me just get peter alexander who's standing out in the freezing cold outside the white house. and what are you hearing from inside the white house about how hillary clinton did yesterday?...
55
55
Jan 24, 2013
01/13
by
CNN
tv
eye 55
favorite 0
quote 0
i don't know that i want the government -- i don't trust the government. do you know what i mean? i'm cynical. i'm a kid of the '60s. >> i understand -- listen, i've tried to immerse myself into all the arguments without taking a sort of lofty, patronizing view of it. i know that many americans share that view. i don't fully understand why there's sort of a fear of tyranny given no overseas tyranny could possibly compete with the american military. >> i think we're worried about tyranny withfrom within. >> you are left with domestic tyranny. if your own government becomes tyrannical they've got 5,000 nuclear warheads. how do you possibly defend yourselves? >> well, you know -- yes. >> nor can i obviously by the way, as many u.s. marines have tweeted me, say, nor can i ever see a situation where the american armed forces would go against their own people. >> well, that's sort of egypt, i guess, when you watched the egyptian military ultimately turn that revolution by saying no, we're not going to gun down egyptians in the street. you hope that's the case. i'm just saying in an esot
i don't know that i want the government -- i don't trust the government. do you know what i mean? i'm cynical. i'm a kid of the '60s. >> i understand -- listen, i've tried to immerse myself into all the arguments without taking a sort of lofty, patronizing view of it. i know that many americans share that view. i don't fully understand why there's sort of a fear of tyranny given no overseas tyranny could possibly compete with the american military. >> i think we're worried about...
196
196
Jan 23, 2013
01/13
by
CNNW
tv
eye 196
favorite 0
quote 0
did the government do enough to protect their citizens? did the state department ignore social security concerns? what are survivors telling investigators, and what's being done to track down the terrorist that laid siege on these offices. it's likely to be a day of blunt questions and intense scrutiny, wolf blitzer is in washington to begin our coverage. >>> good morning, it will be a very important day for the secretary of state this morning. she has a big challenge ahead of her. she has to convince not only men members of the senate, but later the house that she is on top of what happened, why four diplomats were killed, she has to explain what she was doing on that very day. jake tapper is our chief correspondent. it's one of those hearings that we're interested in seeing how tough the questions will wind up being. >> that's right, for secretary of state hillary clinton this is the losing time of her tenure. she'll be leaving in the next few days. this is a rather uncomfortable swan song for her. also, we have some new members includin
did the government do enough to protect their citizens? did the state department ignore social security concerns? what are survivors telling investigators, and what's being done to track down the terrorist that laid siege on these offices. it's likely to be a day of blunt questions and intense scrutiny, wolf blitzer is in washington to begin our coverage. >>> good morning, it will be a very important day for the secretary of state this morning. she has a big challenge ahead of her. she...
98
98
Jan 25, 2013
01/13
by
KQED
tv
eye 98
favorite 0
quote 0
and that actually this transitional government has very little power outside of the capital. and that there are, you know, islamist militias who are basically controlling huge swathes of the rest of the country and not all of them are sympathetic to western or democratic values. and indeed some of them are actively hostile to the u.s. so it kind of changed. everything that americans had kind of believed about like if you give people democracy they'll be happy and they'll like us because we all like democraciment suddenly kind of changed in a moment. and it was like okay, actually that's not necessarily the way things work. and intervention doesn't necessarily mean a happy ending. and i think the syrian people felt that very strongly too. and from a security point of view, if are you the u.s. administration, and are you looking at how qaddafi, odduous though he may have been, he did provide some sort of, he was a linchpin in the region for combatting extremism, for keeping all those groups under control, and now that he's gone it's interesting. you are starting to see already
and that actually this transitional government has very little power outside of the capital. and that there are, you know, islamist militias who are basically controlling huge swathes of the rest of the country and not all of them are sympathetic to western or democratic values. and indeed some of them are actively hostile to the u.s. so it kind of changed. everything that americans had kind of believed about like if you give people democracy they'll be happy and they'll like us because we all...
95
95
Jan 24, 2013
01/13
by
KQED
tv
eye 95
favorite 0
quote 0
whether the taliban will be resurgent, whether the government in afghanistan that will succeed president karzai's will be able to stand. those issues when you push the white house on them i tend to get people saying, look, we're ending these wars. we'll dole with what comes down the road. but we're not going to be deterred from our course. they think thos crucial strategically. they think they're in the business of reestablishing america's image abroad pre-9/11. reestablishing america's alliances and they think they've done that in the first four years and they want to continue it. and finally, the thing that is at the center of the white house's strategic thinking is this idea of rebalancing american power toward asia to dole with the rising china. they don't want anything to get in the way of that, even to the point of leaving what a lot of people fear is a vacuum of american power in areas that traditionally have been crucial to have american power, like the middle east. >> rose: but there's also, when you lock at who is happening in mali and you lock at sort of things that are happen
whether the taliban will be resurgent, whether the government in afghanistan that will succeed president karzai's will be able to stand. those issues when you push the white house on them i tend to get people saying, look, we're ending these wars. we'll dole with what comes down the road. but we're not going to be deterred from our course. they think thos crucial strategically. they think they're in the business of reestablishing america's image abroad pre-9/11. reestablishing america's...
200
200
Jan 24, 2013
01/13
by
CNNW
tv
eye 200
favorite 0
quote 0
government could have been done more? >> i think the syrians, as i said, are the one who is will bring the answer to the problem. just as in iraq, iraqis brought the solution to the iraq crisis, to the iraq war. the americans can help, and we helped in iraq, but ultimately, it wasn't the americans, despite our help, it was iraqis. in syria, again, it has to be syrians who find their way forward. >> reporter: now, wolf, the u.s. has already pledged $210 million in assistance to the 2.6 million syrians who have been displaced by the conflict. it's clearly not enough. there's going to be a donor's conference in kuwait that ambassador ford will be attending to try to attract some more money to it. this problem is enormous and it continues to grow, and sadly, it's not new. there's clearly not enough help for these desperate people fleeing this conflict. wolf? >> ivan watson on the scene for us along the border with syria in turkey. thank you. >>> so many people, you, me, so many people have iphones and macs and ipads, so the r
government could have been done more? >> i think the syrians, as i said, are the one who is will bring the answer to the problem. just as in iraq, iraqis brought the solution to the iraq crisis, to the iraq war. the americans can help, and we helped in iraq, but ultimately, it wasn't the americans, despite our help, it was iraqis. in syria, again, it has to be syrians who find their way forward. >> reporter: now, wolf, the u.s. has already pledged $210 million in assistance to the...
122
122
Jan 23, 2013
01/13
by
MSNBCW
tv
eye 122
favorite 0
quote 0
governments of controlling territory. although there has been the decimation of al qaeda, we do have could contend with the want to bes and affiliated going forward. >> thank you. >> thank you mr. chairman and thank you, madam secretary, for being here. and it's great to see you today. you have been i think a real dedicated public serve ant for your country and your travels around the world, the million miles that you've put on and all of the countries you visited. and i think you've been to many countries where they've never had a secretary of state. and i've seen firsthand when i've been to many of these countries, the difference it makes to have you there on the ground. so i first of all just want to thank you for that and i know it does take a toll but you are incredibly dedicated to that. secondly, it's great to see you here in good health. >> thank you. >> smiling and engaging with all of us. and i want to add to the list people -- senators going down the line talked about some of your accomplishments. i know previo
governments of controlling territory. although there has been the decimation of al qaeda, we do have could contend with the want to bes and affiliated going forward. >> thank you. >> thank you mr. chairman and thank you, madam secretary, for being here. and it's great to see you today. you have been i think a real dedicated public serve ant for your country and your travels around the world, the million miles that you've put on and all of the countries you visited. and i think...
238
238
Jan 23, 2013
01/13
by
CNNW
tv
eye 238
favorite 0
quote 0
and the libyan government. so i did see firsthand what ambassador pickering and chairman mullen called timely and exceptional coordination. no delays and in decision-making, no denials of support from washington or from our military, and i want to echo the review board's praise for the valor and courage of our people on the ground, especially our security professionals in benghazi and tripoli. the board said our response saved american lives in real time and it did. the very next morning i told the american people and i quote, heavily armed militants assaulted our compound and vowed to bring them to justice. and i stood later that day with president obama as he spoke of an act of terror. now, you may recall at the same time period we were also seeing violent attacks on our embassies in cairo, sanaa, tunis and khartoum and large protests outside many other posts from india to indonesia where thousands of our diplomats serve. so i immediately ordered a review of our security posture around the world with particul
and the libyan government. so i did see firsthand what ambassador pickering and chairman mullen called timely and exceptional coordination. no delays and in decision-making, no denials of support from washington or from our military, and i want to echo the review board's praise for the valor and courage of our people on the ground, especially our security professionals in benghazi and tripoli. the board said our response saved american lives in real time and it did. the very next morning i told...
72
72
Jan 23, 2013
01/13
by
MSNBCW
tv
eye 72
favorite 0
quote 0
threaten us in western countries, but the stability and the future of these governments. we have to help them the way we helped columbia. we need to do a better job conveying a counter narrative to the extremist jihadist narrative. i said this to the committee before. we advocated the broadcasting arena. we have private stations and cnn and fox and nbc and all of that. they are out there and convey information, but we are not doing what we did during the cold war. our broadcasting board of governors is practically defunct in terms of the capacity to tell a message around the world. they are advocating the ideological arena and we need to get back into it. we have the best values and narrative. most people in the world want to have a good decent live that is supported by a good decent job and raise their families and letting the jihadist narrative fill a void. we need to get in there and do it successfully. >> from ohio. >> madam secretary, let me thank you for your service. i wish you the best in your future endeavors mostly. [ laughter ] i have a couple of questions, but
threaten us in western countries, but the stability and the future of these governments. we have to help them the way we helped columbia. we need to do a better job conveying a counter narrative to the extremist jihadist narrative. i said this to the committee before. we advocated the broadcasting arena. we have private stations and cnn and fox and nbc and all of that. they are out there and convey information, but we are not doing what we did during the cold war. our broadcasting board of...
100
100
Jan 27, 2013
01/13
by
FOXNEWSW
tv
eye 100
favorite 0
quote 0
here we have an infrastructure project, it doesn't cost the government a dime. all private sector money. yet they are opposing it. it makes no sense. >> we hope he approves it phil mickelson under fire after suggesting he may leave california for more tax friendly local. a look at 8 states he might want to consider when we come back. your boa! [ garth ] thor's small business earns double miles on every purchase, every day! ahh, the new fabrics. put it on my spark card. ow. [ garth ] why settle for less? the spiked heels are working. wait! [ garth ] great businesses deserve great rewards. [ male announcer ] the spark business card from capital one. choose unlimited rewards with double miles or 2% cash back on every purchase, every day! what's in your wallet? [ cheers and applause ] a body at rest tends to stay at rest... while a body in motion tends to stay in motion. staying active can actually ease arthritis symptoms. but if you have arthritis, staying active can be difficult. prescription celebrex can help relieve arthritis pain so your body can stay in motion
here we have an infrastructure project, it doesn't cost the government a dime. all private sector money. yet they are opposing it. it makes no sense. >> we hope he approves it phil mickelson under fire after suggesting he may leave california for more tax friendly local. a look at 8 states he might want to consider when we come back. your boa! [ garth ] thor's small business earns double miles on every purchase, every day! ahh, the new fabrics. put it on my spark card. ow. [ garth ] why...
94
94
Jan 23, 2013
01/13
by
MSNBCW
tv
eye 94
favorite 0
quote 0
we are in close touch with the government of algeria. we stand ready to provide assistance. we are seeking to gain a fuller understanding of what took place, so we can work together with algerians and others to prevent such terrorist attacks in the future. concerns about terrorism and instability in north africa are, of course, not new. they have been a top priority for the entire administration's national security team. but we have been facing a rapidly changing threat environment, and we have had to keep working at ways to increase pressure on al qaeda and the islamic maghreb and the other terrorist groups in the region. in the first hours and days, i conferred with leaders, the president of libya, foreign ministers of tunisia and morocco, and then i had a series of meetings at the united nations' general assembly, where there was a special meeting focused on mali and the sahel. in october, i flew to algeria to discuss the fight against aqim. in november, i spent deputy secretary bill burns to follow up in algiers, and then in december, in my instestead, he co-chaired an o
we are in close touch with the government of algeria. we stand ready to provide assistance. we are seeking to gain a fuller understanding of what took place, so we can work together with algerians and others to prevent such terrorist attacks in the future. concerns about terrorism and instability in north africa are, of course, not new. they have been a top priority for the entire administration's national security team. but we have been facing a rapidly changing threat environment, and we have...
74
74
Jan 24, 2013
01/13
by
KQED
tv
eye 74
favorite 0
quote 0
this will be a very difficult negotiation to put together for the government. when you take a look at this, if bebe wanted to go for a purely secular government he would go governor lapid and bennett. lapid will also require domestic policies and an approach on the peace issue that bennett can't tolerate. if on the other hand bebe wanted to go for something that would be lapid on the one hand, you would have the same contradiction but the difference of the religious versus the secular. it will be a very difficult negotiation to put together. in the end, he will succeed but those parties like lapid-- lapid has enormous leverage right now and i dont expect he's going to give it away fair sopg. >> rose: what should be the united states' position right now, what this shea be dag? first question. second question, we're getting a new secretary of state, does that change the dynamic at all because of john kerry and his involvement from the middle east, especially with the syrians and others. >> i would say-- look, i think the-- in kerry's case, he will have an interes
this will be a very difficult negotiation to put together for the government. when you take a look at this, if bebe wanted to go for a purely secular government he would go governor lapid and bennett. lapid will also require domestic policies and an approach on the peace issue that bennett can't tolerate. if on the other hand bebe wanted to go for something that would be lapid on the one hand, you would have the same contradiction but the difference of the religious versus the secular. it will...
218
218
Jan 28, 2013
01/13
by
FOXNEWSW
tv
eye 218
favorite 0
quote 0
the legislative branch of our government. and i am certainly going to hold up our team model whatever it happens to be whoever the president happens to be but i want to put this in perspective. we have seen this president denied the opportunity to make appointments over and over and over again because one senator happens to hate a particular agency or a particular person. for goodness sakes in fairness give them a hearing and give them a vote and let's get on with it. >> chris: want to respond to that? >> i do think we did something very good thursday night in that we didn't blow the senate up. i would say in the case of the nlrb nominees there was never a hearing. so in that case it was incredibly abusive and again i'm glad the court has struck this down and hopefully we will get back to regular order and doing things the way we should be in the senate. >> chris: let's turn to the president's inaugural agenda for a second term. i think it is fair to say it is a pretty liberal agenda. here is what he said during his address.
the legislative branch of our government. and i am certainly going to hold up our team model whatever it happens to be whoever the president happens to be but i want to put this in perspective. we have seen this president denied the opportunity to make appointments over and over and over again because one senator happens to hate a particular agency or a particular person. for goodness sakes in fairness give them a hearing and give them a vote and let's get on with it. >> chris: want to...
135
135
Jan 23, 2013
01/13
by
MSNBCW
tv
eye 135
favorite 0
quote 0
i directed and stayed in close contact with officials from across the government and the libyan government. i did see what the ambassador and the chairman called timely and exceptional coordination. no delays in decision making and no denials of support from washington or the military. i want to echo the praise for the valor and courage of the people on the ground, especially security professionals in benghazi and tripoli. the board said our response saved lives in realtime and it did. the very next morning, i told the american people and i quote, heavily armed militants assaulted the compound and vowed to bring them to justice. i stood later that day with president obama as he spoke of an act of terror. you may recall at the same time period we were also seeing violent attacks on our embassies in cairo, tunas as well as large protests outside many other posts from india to indonesia where thousands of our diplomats serve. i ordered a review of the security posture around the world with particular scrutiny for high threat posts. i asked the department of defense to join inner agency securi
i directed and stayed in close contact with officials from across the government and the libyan government. i did see what the ambassador and the chairman called timely and exceptional coordination. no delays in decision making and no denials of support from washington or the military. i want to echo the praise for the valor and courage of the people on the ground, especially security professionals in benghazi and tripoli. the board said our response saved lives in realtime and it did. the very...